Tender No.CONSUMABLES/18-19/FRPDF /DEPARTMENT OF LIFE SCIENCES /SENGUPTA-1   Dated:11.12.2018

Sealed quotations are invited from the Enlisted Vendors of the University to quote their lowest possible rate for the supply of the under-mentioned goods/articles, subject to the following terms and conditions. The quotations must be submitted to Dr. SUGOPA SENGUPTA of Department of LIFE SCIENCES____ of the University.

Last date & time for submission of quotation is ………18th December, 2018… up to 3.30 P.M.

Consignment in details:-

Sl. No.

NAME

SEQUENCE OF OLIGO

Make

Qnty

Scale ( µmole )

Purification

Format

1

SSG9

GATCGTCATATGATGCCTGTCCCATCTGTTAC

Sigma Aldrich

1

0.05

HPLC

Dry

2

SSG10

TCTCGAGGGGCCCTTAATCGAAAATTCTATG

Sigma Aldrich

1

0.05

HPLC

Dry

3

SSG11

CATAAATCAGAAAAGGGGATCAAGGGGTTTTTTCATAGAATTTTCGATCGTACGCTGCAGGTCGAC

Sigma Aldrich

1

0.2

PAGE

Dry

4

SSG12

GCGCTTTAGGAATTGAACGAAAAAGTCGAAAGCTAGGCAGATGCCAAGATCGATGAATTCGAGCTCG

Sigma Aldrich

1

0.2

PAGE

Dry

5

SSG13

CATATGCGCGATTGCTGATC

Sigma Aldrich

1

0.025

Desalt

Dry

6

SSG14

AATAGGTCAGGCTCTCGCTG

Sigma Aldrich

1

0.025

Desalt

Dry

7

SSG15

AGTAACAAACTCAGCTCACG

Sigma Aldrich

1

0.025

Desalt

Dry

8

SSG16

ATACTTTAGCCACAGGTGTG

Sigma Aldrich

1

0.025

Desalt

Dry

9

SSG17

CAATTAAATCTGCTGGACTGTCTGCTCTTGCAG

Sigma Aldrich

1

0.05

HPLC

Dry

10

SSG18

GAGCAGACAGTCCAGCAGATTTAATTGATAAACC

Sigma Aldrich

1

0.05

HPLC

Dry

11

SSG19

CAAGAAAATATGGTTTATCAATTGCTTCTGATGGACTGTCTGCTC

Sigma Aldrich

1

0.05

HPLC

Dry

12

SSG20

GAGCAGACAGTCCATCAGAAGCAATTGATAAACCATATTTTCTTG

Sigma Aldrich

1

0.05

HPLC

Dry

13

SSG21

GAGGCCTTTTCATCGCTCAGAGCGGGGTTAAAGAAG

Sigma Aldrich

1

0.05

HPLC

Dry

14

SSG22

CTTTAACCCCGCTCTGAGCGATGAAAAGGCCTC

Sigma Aldrich

1

0.05

HPLC

Dry

15

SSG23

CTGGCGTATAGAGTTTTATCAAGAGCTTATGGTTTATCAATTAAATCTG

Sigma Aldrich

1

0.05

HPLC

Dry

16

SSG24

CAGATTTAATTGATAAACCATAAGCTCTTGATAAAACTCTATACGCCAG

Sigma Aldrich

1

0.05

HPLC

Dry

17

SSG25

GATGGACTGTCTGCTGCTGCAGAATTCGTTGGCAC

Sigma Aldrich

1

0.05

HPLC

Dry

18

SSG26

GCCAACGAATTCTGCAGCAGCAGACAGTCCATCAG

Sigma Aldrich

1

0.05

HPLC

Dry

19

SSG27

GCTACAATAAAATTTCTCGCTCAATTTGCTGCAGTATGG

Sigma Aldrich

1

0.05

HPLC

Dry

20

SSG28

CCATACTGCAGCAAATTGAGCGAGAAATTTTATTGTAGC

Sigma Aldrich

1

0.05

HPLC

Dry

21

SSG29

CAAGAAAATATGGTTTATCAGCTGCTTCTGATGGACTGTCTGCTCTTGC

Sigma Aldrich

1

0.05

HPLC

Dry

22

SSG30

GCAAGAGCAGACAGTCCATCAGAAGCAGCTGATAAACCATATTTTCTTG

Sigma Aldrich

1

0.05

HPLC

Dry

23

SSG31

CAAGAAAGAGGCCTTTTCGCTGCTCAGAGCGGGGTTAAAGAAG

Sigma Aldrich

1

0.05

HPLC

Dry

24

SSG32

CTTCTTTAACCCCGCTCTGAGCAGCGAAAAGGCCTCTTTCTTG

Sigma Aldrich

1

0.05

HPLC

Dry

S. No

PRODUCT NAME

MAKE

CATALOGUE No.

PACKING

QUANTITY

25

Monoclonal ANTI-FLAG® M2 antibody produced in mouse

Sigma-Aldrich/ Abcam

F3165-0.2mg

0.2mg

1

26

Nco I- HF

New England Biolabs

R3193S

20,000U/ml

1000U

27

NheI-HF

New England Biolabs

R3131S

1

1000U

28

T4 DNA Ligase

Promega

M1801

1

100U

29

X ray film cassette (compatible with 10 X 8 inch Kodak films)

Kiron

CS0810

Each

1

30

Hydroxyurea

HiMedia

RM6487

5gm

2

31

Micro Tips 2-200µl

Tarsons

521010

1000/pk

2

32

Micro Tips 200-1000µl

Tarsons

521020

500/pk

4

33

Spinwin Micro Centrifuge Tubes 1.5 ml

Tarsons

500010

500/pk

2

34

Petri dishes non-vented

Tarsons

460030

480 pcs/pk

2

Note: a) The sealed cover should be duly superscribed with the enquiry no & date and name of the item quoted in block letter.

b) Party is requested to keep in touch with Dr. SUGOPA SENGUPTA of Department of LIFE SCIENCES, Presidency University before quoting the rate for better knowledge of specification, quality of material, etc.

c) Warranty must be mentioned in your offer for all the above items.

d) Please make sure to mention unit price and cumulative price for all items that should be inclusive of all taxes, duties and other charges as stated in point no.3 below.

e) Rate and amount of GST for each item is to be specified in the quotation.

Finance Officer

Terms & conditions of the Quotation:-

1. The bidder must be GST-Registered (photocopy of the GST Registration Certificate to be provided along with the quotation). Quotations of the unregistered dealers would be summarily rejected.

2. The quotations should be made by the vendors in their original letterheads clearly indicating the aforesaid goods/articles in details.

3. Price quoted should be inclusive of GST, installation, commissioning and delivery charges up to Presidency University.

4. Rate and amount of GST for each item is to be specified in the quotation.

5. DSIR Certificate would be provided to the L-1 Vendor against Proforma Invoice, if necessary, for the purpose of exemption of Customs duty / GST as per the extant Rules and Notifications.

6. The above Rate Format is to be strictly followed. In case a bidder is unable to quote the rate against any item, the rate should remain blank for the respective Serial No. But in no case the row against the said Serial No. should be deleted by the Bidder.

7. Validity of the quotation will be at least 3(three) months from the closing date of the enquiry.

8. Sample must be attached with quotation in all possible cases.

9. Our enquiry no and date & Purchase order no. and date must be quoted on all correspondences and those should be duly signed and seal.

10. Bidders must as far as possible, arrange to supply the materials within the stipulated time mentioned in the purchase order. This delivery time must be strictly adhered to. Failure to supply within the specified time will lead to cancellation of the order without notice.

11. The University reserves the right to accept or reject any quotation in part or full without assigning any reason thereto.

12. In all cases of disputes, the decision of the University shall be final & binding on you.

By order

How to Find Us

Presidency University
86/1 College Street
Kolkata 700073
Contact details Presidency University Students Corner

RTI