Tender Notice No: - CONSUMABLES/19-20/PU/DLSBT (2nd Camp)/3 dated 13/01/2020

Sealed quotations are invited from the Enlisted Vendors of the University to quote their lowest possible rate for the supply of the under-mentioned goods/articles, subject to the following terms and conditions. The quotations must be submitted to Dr. Chandrama Mukherjee of Department of Life Sciences of the University.

Last date & time for submission of quotation is 20.01.2020 up to 3.30 P.M.

Consignment in details:-

Sl No

Particulars

Brand/

Make

Approx. Qty.

1

Abscisic acid (ABA) , Himedia PCT0815

Himedia

1

2

Acetosyringone, HImedia PCT 1301

HiMedia

1

3

alpha-napthol, GRM389

HiMedia

1

4

Barritt's reagent A, Himedia-R029

HiMedia

1

5

Barritt's reagent B, Himedia-R030

HiMedia

1

6

Cefotaxime HIMEDIA MB134

HiMedia

1

7

Chloramine T Himedia GRM499

HiMedia

1

8

Chloramphenicol,CMS218-5G

HiMedia

1

9

Cobalt chloride hexahydrate, PCT0103-100G

HiMedia

1

10

Dextrose, RM1367-500G

HiMedia

1

11

dichloro-phenoxy acetic acid (2,4-D), Himedia PCT0825-100G

HiMedia

1

12

dipotasium phosphate, Himedia MB044

HiMedia

1

13

EDTA disodium salt dihydrate, Himedia MB011-500G

HiMedia

1

14

EMB Agar, Himedia-M317

HiMedia

1

15

Endo Agar, Himedia-M029

HiMedia

1

16

Ferric-EDTA , Himedia PCT0106-100G

HiMedia

1

17

Ferrous sulphate heptahydrate , sigma F8263-500G

Sigma

1

18

Glucose-Peptone broth,Himedia-M758

HiMedia

1

19

Hydrocloric acid 37%, AS003-2.5L

HiMedia

2

20

Hydrogen Peroxide, HIMEDIA pct 1511

HiMedia

2

21

indole acetic acid (IAA), Himedia PCT0803-5G

HiMedia

1

22

Indole-3-butyric acid (IBA), Himedia PCT0804-5G

HiMedia

1

23

isopentenyl adenine (2iP), Himedia PCT0807-5G

HiMedia

1

24

Jensen’s media, Himedia M710-500G

HiMedia

1

25

kinetin, Himedia PCT0806-5G

HiMedia

1

26

Kovac's reagent, Himedia-R008-100ML

HiMedia

1

27

Lactophenol-cotton blue,Himedia-S016-100ML

HiMedia

1

28

Kanamycin sulphate, MB105-5G

HiMedia

1

29

Lead acetate agar, Himedia-M180-500G

HiMedia

1

30

Methyl Red indicator, Himedia-I007

HiMedia

1

31

monopotasium phosphate, Himedia- MB050-100G

HiMedia

1

32

Murashige and Skoog Basal Medium, PT021

HiMedia

1

33

Nutrient Agar, M001-500G

HiMedia

1

34

PCR purification kit, MB512-20PR

HiMedia

1

35

myo-Inositol, Sigma I7508-50G

Sigma

1

36

naphthalene acetic acid, Sigma N4002-5G-A

Sigma

1

37

Nicotinic acid (free acid), Sigma 72309-100G

Sigma

1

38

Phytagel, Sigma P8169-100G

Sigma

1

39

Potassium Nitrate, GRM3946-500G

Himedia

1

40

Potato dextrose broth, Himdia GM 403

Himedia

1

41

Potato dextrose agar, Himedia M096

Himedia

1

42

Simmons' citrate agar Himedia,M099-500G

Himedia

1

43

Sodium alginate Himedia MB114

Himedia

1

44

Starch Agar Himedia-M107

Himedia

1

45

Tryptone broth Himedia M463-500G

Himedia

1

46

Urea agar base Himedia M112-100G

Himedia

1

47

Neutral Red stain Himedia-S037

Himedia

1

48

HiPer® IgG Purification Teaching Kit, HTI022

Himedia

1

49

HiPer® Antibody Capture ELISA Teaching Kit,HTI013

Himedia

1

50

HiPer Western Blotting Teaching Kit, Himedia HTI009-5PR

Himedia

1

51

Anti-GST antibody, Sigma G7781-25UL

Sigma

1

52

DNA Oligo, desalted, 27f (AGAGTTTGATCCTGGCTCAG)

Sigma

0.025uM

53

DNA Oligo, desalted, 1492r (GGYTACCTTGTTACGACTT)

Sigma

0.025uM

54

DNA Oligo, desalted, ITS1F (F) (CTTGGTCATTTAGAGGAAGTAA)

Sigma

0.025uM

55

DNA Oligo, desalted, ITS4 (R) TCCTCCGCTTATTGATATGC

Sigma

0.025uM

Note: a) The sealed cover should be duly superscribed with the enquiry no & date and name of the item quoted in block letter.

b) Party is requested to keep in touch with Dr. Chandrama Mukherjee of Department of Life Sciences, Presidency University before quoting the rate for better knowledge of specification, quality of material, etc.

c) Warranty must be mentioned in your offer for all the above items.

d) Please make sure to mention unit price and cumulative price for all items that should be inclusive of all taxes, duties and other charges as stated in point no.3 below.

Finance Officer

Terms & conditions of the Quotation:-

1. The bidder must be GST-Registered (photocopy of the GST Registration Certificate to be provided along with the quotation). Quotations of the unregistered dealers would be summarily rejected.

2. The quotations should be made by the vendors in their original letterheads clearly indicating the aforesaid goods/articles in details.

3. Price quoted should be inclusive of GST, installation, commissioning and delivery charges up to Presidency University.

4. Rate and amount of GST for each item is to be specified in the quotation.

5. DSIR Certificate would be provided to the L-1 Vendor against Proforma Invoice, if necessary, for the purpose of exemption of Customs duty / GST as per the extant Rules and Notifications.

6. The above Rate Format is to be strictly followed. In case a bidder is unable to quote the rate against any item, the rate should remain blank for the respective Serial No. But in no case the row against the said Serial No. should be deleted by the Bidder.

7. The cumulative price (for all items) will be considered for bidding and determining L-1 vendor.

8. Validity of the quotation will be at least 3(three) months from the closing date of the enquiry.

9. Sample must be attached with quotation in all possible cases.

10. Our enquiry no and date & Purchase order no. and date must be quoted on all correspondences and those should be duly signed and seal.

11. Bidders must as far as possible, arrange to supply the materials within the stipulated time mentioned in the purchase order. This delivery time must be strictly adhered to. Failure to supply within the specified time will lead to cancellation of the order without notice.

12. The University reserves the right to accept or reject any quotation in part or full without assigning any reason thereto.

13. In all cases of disputes, the decision of the University shall be final & binding on you.

By order

How to Find Us

Presidency University
86/1 College Street
Kolkata 700073
Contact details Presidency University Students Corner

RTI