![](images/commonheader.jpg)
Tender Notice No: - CONSUMABLES/19-20/PU/DLSBT (2nd Camp)/3 dated 13/01/2020
Sealed quotations are invited from the Enlisted Vendors of the University to quote their lowest possible rate for the supply of the under-mentioned goods/articles, subject to the following terms and conditions. The quotations must be submitted to Dr. Chandrama Mukherjee of Department of Life Sciences of the University.
Last date & time for submission of quotation is 20.01.2020 up to 3.30 P.M.
Consignment in details:-
Sl No |
Particulars |
Brand/ Make |
Approx. Qty. |
1 |
Abscisic acid (ABA) , Himedia PCT0815 |
Himedia |
1 |
2 |
Acetosyringone, HImedia PCT 1301 |
HiMedia |
1 |
3 |
alpha-napthol, GRM389 |
HiMedia |
1 |
4 |
Barritt's reagent A, Himedia-R029 |
HiMedia |
1 |
5 |
Barritt's reagent B, Himedia-R030 |
HiMedia |
1 |
6 |
Cefotaxime HIMEDIA MB134 |
HiMedia |
1 |
7 |
Chloramine T Himedia GRM499 |
HiMedia |
1 |
8 |
Chloramphenicol,CMS218-5G |
HiMedia |
1 |
9 |
Cobalt chloride hexahydrate, PCT0103-100G |
HiMedia |
1 |
10 |
Dextrose, RM1367-500G |
HiMedia |
1 |
11 |
dichloro-phenoxy acetic acid (2,4-D), Himedia PCT0825-100G |
HiMedia |
1 |
12 |
dipotasium phosphate, Himedia MB044 |
HiMedia |
1 |
13 |
EDTA disodium salt dihydrate, Himedia MB011-500G |
HiMedia |
1 |
14 |
EMB Agar, Himedia-M317 |
HiMedia |
1 |
15 |
Endo Agar, Himedia-M029 |
HiMedia |
1 |
16 |
Ferric-EDTA , Himedia PCT0106-100G |
HiMedia |
1 |
17 |
Ferrous sulphate heptahydrate , sigma F8263-500G |
Sigma |
1 |
18 |
Glucose-Peptone broth,Himedia-M758 |
HiMedia |
1 |
19 |
Hydrocloric acid 37%, AS003-2.5L |
HiMedia |
2 |
20 |
Hydrogen Peroxide, HIMEDIA pct 1511 |
HiMedia |
2 |
21 |
indole acetic acid (IAA), Himedia PCT0803-5G |
HiMedia |
1 |
22 |
Indole-3-butyric acid (IBA), Himedia PCT0804-5G |
HiMedia |
1 |
23 |
isopentenyl adenine (2iP), Himedia PCT0807-5G |
HiMedia |
1 |
24 |
Jensen’s media, Himedia M710-500G |
HiMedia |
1 |
25 |
kinetin, Himedia PCT0806-5G |
HiMedia |
1 |
26 |
Kovac's reagent, Himedia-R008-100ML |
HiMedia |
1 |
27 |
Lactophenol-cotton blue,Himedia-S016-100ML |
HiMedia |
1 |
28 |
Kanamycin sulphate, MB105-5G |
HiMedia |
1 |
29 |
Lead acetate agar, Himedia-M180-500G |
HiMedia |
1 |
30 |
Methyl Red indicator, Himedia-I007 |
HiMedia |
1 |
31 |
monopotasium phosphate, Himedia- MB050-100G |
HiMedia |
1 |
32 |
Murashige and Skoog Basal Medium, PT021 |
HiMedia |
1 |
33 |
Nutrient Agar, M001-500G |
HiMedia |
1 |
34 |
PCR purification kit, MB512-20PR |
HiMedia |
1 |
35 |
myo-Inositol, Sigma I7508-50G |
Sigma |
1 |
36 |
naphthalene acetic acid, Sigma N4002-5G-A |
Sigma |
1 |
37 |
Nicotinic acid (free acid), Sigma 72309-100G |
Sigma |
1 |
38 |
Phytagel, Sigma P8169-100G |
Sigma |
1 |
39 |
Potassium Nitrate, GRM3946-500G |
Himedia |
1 |
40 |
Potato dextrose broth, Himdia GM 403 |
Himedia |
1 |
41 |
Potato dextrose agar, Himedia M096 |
Himedia |
1 |
42 |
Simmons' citrate agar Himedia,M099-500G |
Himedia |
1 |
43 |
Sodium alginate Himedia MB114 |
Himedia |
1 |
44 |
Starch Agar Himedia-M107 |
Himedia |
1 |
45 |
Tryptone broth Himedia M463-500G |
Himedia |
1 |
46 |
Urea agar base Himedia M112-100G |
Himedia |
1 |
47 |
Neutral Red stain Himedia-S037 |
Himedia |
1 |
48 |
HiPer® IgG Purification Teaching Kit, HTI022 |
Himedia |
1 |
49 |
HiPer® Antibody Capture ELISA Teaching Kit,HTI013 |
Himedia |
1 |
50 |
HiPer Western Blotting Teaching Kit, Himedia HTI009-5PR |
Himedia |
1 |
51 |
Anti-GST antibody, Sigma G7781-25UL |
Sigma |
1 |
52 |
DNA Oligo, desalted, 27f (AGAGTTTGATCCTGGCTCAG) |
Sigma |
0.025uM |
53 |
DNA Oligo, desalted, 1492r (GGYTACCTTGTTACGACTT) |
Sigma |
0.025uM |
54 |
DNA Oligo, desalted, ITS1F (F) (CTTGGTCATTTAGAGGAAGTAA) |
Sigma |
0.025uM |
55 |
DNA Oligo, desalted, ITS4 (R) TCCTCCGCTTATTGATATGC |
Sigma |
0.025uM |
Note: a) The sealed cover should be duly superscribed with the enquiry no & date and name of the item quoted in block letter.
b) Party is requested to keep in touch with Dr. Chandrama Mukherjee of Department of Life Sciences, Presidency University before quoting the rate for better knowledge of specification, quality of material, etc.
c) Warranty must be mentioned in your offer for all the above items.
d) Please make sure to mention unit price and cumulative price for all items that should be inclusive of all taxes, duties and other charges as stated in point no.3 below.
Finance Officer
Terms & conditions of the Quotation:-
1. The bidder must be GST-Registered (photocopy of the GST Registration Certificate to be provided along with the quotation). Quotations of the unregistered dealers would be summarily rejected.
2. The quotations should be made by the vendors in their original letterheads clearly indicating the aforesaid goods/articles in details.
3. Price quoted should be inclusive of GST, installation, commissioning and delivery charges up to Presidency University.
4. Rate and amount of GST for each item is to be specified in the quotation.
5. DSIR Certificate would be provided to the L-1 Vendor against Proforma Invoice, if necessary, for the purpose of exemption of Customs duty / GST as per the extant Rules and Notifications.
6. The above Rate Format is to be strictly followed. In case a bidder is unable to quote the rate against any item, the rate should remain blank for the respective Serial No. But in no case the row against the said Serial No. should be deleted by the Bidder.
7. The cumulative price (for all items) will be considered for bidding and determining L-1 vendor.
8. Validity of the quotation will be at least 3(three) months from the closing date of the enquiry.
9. Sample must be attached with quotation in all possible cases.
10. Our enquiry no and date & Purchase order no. and date must be quoted on all correspondences and those should be duly signed and seal.
11. Bidders must as far as possible, arrange to supply the materials within the stipulated time mentioned in the purchase order. This delivery time must be strictly adhered to. Failure to supply within the specified time will lead to cancellation of the order without notice.
12. The University reserves the right to accept or reject any quotation in part or full without assigning any reason thereto.
13. In all cases of disputes, the decision of the University shall be final & binding on you.
By order
About Presidency
Quick Links
Students
- Admissions
- Examinations
- GE/AECC
- Dean of Students Corner
- Career Counselling
- International Students
- PhD Students
- Student Grievance Redressal Committee (SGRC)
- Internal Committee for Persons with Disabilities
- Equal Opportunity Cell
- Anti-Ragging
- Internal Complaints Committee (ICC)
- Gender Sensitization and Prevention of Sexual Harassment Cell(GSPSHC)
- Migration
How to Find Us
Presidency University
(Main Campus)
86/1 College Street
Kolkata 700073
Presidency University
(2nd Campus)
Plot No. DG/02/02,
Premises No. 14-0358, Action Area-ID
New Town
(Near Biswa Bangla Convention Centre)
Kolkata-700156
Contact details Presidency University Students Corner